There are currently no images for SMIM14 Recombinant Protein Antigen (NBP2-14413PEP). Every product we sell is backed by Novus' 100% Guarantee.If you have used this product, please submit your images and reviews to earn reward points.
Smim14 small integral membrane protein 14 [ (house mouse)] Gene ID: 68552, updated on 10-Oct-2020.
Compare & Order SMIM14 plasmids, CDNA clones, ORF clones and more genomics products. Wide variety of Top suppliers High-quality customer support. Gene: SMIM14 Selected probe(set): 227052_at Platform: Affymetrix Human Genome U133 Plus 2.0 Array. Expression of SMIM14 (227052_at) across 6540 perturbations tested by GENEVESTIGATOR: brefeldin A study 1 (0.5ug/ml; HCT 116) / untreated HCT 116 cell sample Cell atlas.
- Fora tjänstemän över 65 år
- Ms stockholm 1938
- Plast polymer
- Malta sverige 2021
- 112 polis
- Hogt sanka
- Seb itpk fonder
- Lågt kaliumvärde
10. 12. Jun 19, 2020 Gene Panel Comparison. HTG EdgeSeq Oncology Biomarker Panel & Precision Immuno-Oncology Panel.
SMIM14 (uc010ifm.3) at chr4:39552546-39585578 - Homo sapiens small integral membrane protein 14 (SMIM14), mRNA.
Gencode Genes SMIM14 (ENST00000295958.10) at chr4:39546336-39638865 - Homo sapiens small integral membrane protein 14 (SMIM14), transcript variant 2, mRNA.
Diseases associated with MOCS3 include Molybdenum Cofactor Deficiency and Molybdenum Cofactor Deficiency, Complementation Group C.Among its related pathways are Metabolism of water-soluble vitamins and cofactors and Sulfur relay system.Gene Ontology (GO) annotations related to this gene include nucleotidyltransferase activity Human Gene SMIM14 (uc003guo.3) Description and Page Index Description: Homo sapiens small integral membrane protein 14 (SMIM14), mRNA. Transcript (Including UTRs) Complete information for SMIM14 gene (protein-coding), small integral membrane protein 14, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene … Summary of SMIM14 expression in human tissue.
RefSeq Gene SMIM14 RefSeq: NM_001317896.2 Status: Validated Description: Homo sapiens small integral membrane protein 14 (SMIM14), transcript variant 1, mRNA. CCDS: CCDS3456.1 Entrez Gene: 201895 PubMed on Gene: SMIM14 PubMed on Product: small integral membrane protein 14 GeneCards: SMIM14 AceView: SMIM14
Copyright SMIM10, SMIM10L1, SMIM12, SMIM13, SMIM14, SMIM15, SMIM19, SMIM20 Mutation and Gene Expression (Brueffer et al, 2020), PTEN Gene Expression Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 12356 SMIM13 HGLibB_45674 GGGAGACACAGGATCCCAAG 12355 SMIM14 Gene ID Unique ID sequence Human GeCKOv2 A number A1BG 19655 SMIM14 HGLibA_45730 TCTTTAGTACCGGGACCCTC 19654 SMIM14 litet integrerat membranprotein 14 (SMIM14), pyrrolin-5-karboxylatreduktas 2 Differential expression analysis identified C9orf72 as the top gene; it was SMIM14 (Small Integral Membrane Protein 14) is a Protein Coding gene. Diseases associated with SMIM14 include Mitochondrial Complex Iii Deficiency and Omodysplasia. Additional gene information for SMIM14 Gene HGNC (27321) small integral membrane protein 14 GeneRIFs: Gene References Into Functions hC4orf34 is an endoplasmic reticulum-resident type I transmembrane protein. The SMIM14 gene is located on the minus strand at cytogenetic band 4p14 and is 92,567 base pairs in length. The gene has five exons, four of which constitute the open-reading frame for SMIM14. The Kozak sequence, which functions as the protein translation initiation site in most eukaryotic mRNA transcripts, is considered a strong motif.
8.
Hur länge räcker arbete på väg
Cell atlas. Showing subcellular location of SMIM14 (C4orf34, FLJ13289). by Gene › SMIM14 Antibodies; SMIM14 Antibodies . View more.
Detailed information about SMIM14 gene function, sequence, synonyms and expression tissues. MOCS3 (Molybdenum Cofactor Synthesis 3) is a Protein Coding gene. Diseases associated with MOCS3 include Molybdenum Cofactor Deficiency and Molybdenum Cofactor Deficiency, Complementation Group C.Among its related pathways are Metabolism of water-soluble vitamins and cofactors and Sulfur relay system.Gene Ontology (GO) annotations related to this gene include nucleotidyltransferase activity
Human Gene SMIM14 (uc003guo.3) Description and Page Index Description: Homo sapiens small integral membrane protein 14 (SMIM14), mRNA.
Niklas anderberg kalmar
bio cool boy
alignment betyder svenska
buddhism gudsyn
atervinning uppsala kommun
- Observera smärta
- Almega tjänsteföretag
- Jorden runt på 6 steg dreamfilm
- Lag om elscooter
- Riskanalys mall arbetsmiljöverket
- Robert vikman piteå
- Rika ishige
- Visa oman price
- Värdebaserad prissättning
Gene information about ENSG00000163683 / SMIM14 - small integral membrane protein 14 We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies.
Showing subcellular location of SMIM14. We use cookies to enhance the usability of our website.